miércoles, 25 de marzo de 2009

PuRoOo pEdiGriIi

Alguna vez se han puesto a pensar que en su excelente anatomia hay alguna parte que esta medio extrañia?? Asi como que no hace juego con sus demas rasgos?? Como si se vieran al espejo y pensaran "pues si, no estoy tan mal, casi soy perfecto sino fuera X esto", no se, X decir algo, la nariz grande, los ojos pequeñios, el brazo muy delgado, la panza muy abultada (jajajaja) o algo X el estilo.

Bueno a mi casi nunca me pasa, solo lo usual en una mujer ya saben, hay se me ve muchio el callo de la andadera (jeje) y no me gusta, o hay esos dias en lso que siento que nada se me ve bien, sobre todo cuando me desvelo, o en esos dias que comienzo a sentir colicos, nunca se me inflama el estomago pero yo me siento la mujer menos setsy de mexicali, odio los desordenes hormonales.

Ah pero me estoy saliendo del tema, yo si tengo una parte de mi cuerpo que siento que no corresponde a mi hermosa y casi perfecta anatomia XD, y gracias al cielo no es algoq ue la gente pueda ver a simple vista, de hecho son muy pocos los que han tenido el honor de conocerla, observarla detenidamente y muy de cerca y aveces si estoy de buen humosr y no me gana la risa hasta de tocarla!!
¿Kieren saber de que parte de mi cuepecito estoy hablando???

Mi LeEeNgUuaAaaa!!!!

Si asi es mis queridos blogueros, esta es mi lengua, esta es la parte de mi anatomia que creo que no hace juego con todo mi ser, a poco no se han percatado de loq ue les hablo??? Pero si esta mas que obvio en la foto!!
Mi lengua tiene un monton de manchas negras o.O
No me van a decir que es normal, porque yo nunca he visto algo parecido en un humano, solo en los perros shaw shaw, mi papa dice que al menos eso es señial de que soy de raza pura.

La verdad es que no he querido buscar en la enciclopedia del conocimiento mundial (o sea el internet) que tal que descubro que es una enfermedad rara o algo X el estilo, qu etal que me dicen que es contagioso y ya nadien me va a querer besar nunca jamas, que talq ue me preguntan ¿donde estubo esa lengua anteriormente? nooooo para evitarme el bochorno mejor asi que quede.

24 comentarios:

CRUDO dijo...

Fiu fiuuu fiu aca aca ven, haber haber la patita....... esoooo muuuuy bien!!!! jajajajaja NTC ya sabes que me encanta esa lengua de chau chau jajajaja

chOcolAte sEnXuAl dijo...

guaaaaaaaauuf

guuuuuuuuuaaaaaaaaauffff

grrrrrrrrrrrrrr

ay no en la orejita no XP

malhechecito dijo...

Ja ja ja Choco, lo mio es la panzota chelera, te la rifas con tus post, oye y donde vives pues??? Mexicali o Michoacan???, una vez lei que en Michoacan, aclarame.
Un saludo

jess dijo...

Jajajaja es más fácil que yo encuentre mis partes extrañas que mis virtudes anatómicas jajajaja......

Yo pensaba que tenía una lengua normal pero por lo recién leído aquí, ni eso =P

Ciao Bambina!

el pacorro dijo...

jajajajaja

como te atreves en una de esas te enteras que padeces de una rara enfermedad y vana venir por ti para estudiarte

Aigeus Kjell dijo...

Saludos Chocolate, mi primer comentario en tu blog.

Pues si te confieso que nunca me había tocado saber de alguien con un rasgo así como el tuyo pero mientras no sea un problema de salud pues es una característica que te distingue.

Yo por mi parte te puedo decir que soy perfecto de las rodillas para abajo y de las hombros hacia los dedos... todo lo que queda entre estos puntos es una cosa extraña...jaja

Saludos y mucho gusto.

CHOPINGO dijo...

me acostumbre a mi....he cinseguido ignorarme.

P´PITO dijo...

son fuegos de algun antojo que no se te cumplio!!!

despues sigue el algodoncillo....
la depellejada, mal olor y terminas con lengua partida....

jajajjajaja

saludos!!!

Lord Vyzarro dijo...

jojojojojojojojojojojojoj lengua de chau chau jojojojojojooojo, lo siento pero me fue inevitable leer ese coment, genial por cierto, pero ps no o veo tan anormal al menos a mi no me sorprende, por cierto, yo te imaginaba asi como mas morenita, por tu mote de chocolata, pero nada que ver, bueno haber cuando me dejas conocerte en alguna foto, saludossss!!!!

Pandora! dijo...

baaah, creo que todos somos inconformes con lo que somos, yo tan solo en ocasiones no encuentro ni una parte de la cual pueda hablar bonito de mi físico. Y aunque fueramos top models seguiríamos encontrándonos cosas que no nos gustan. Sientete a gusto contigo!!!

LAGARTO dijo...

todos tenemos nuestro propio sello y nustestro defecto de fabrica jaja es lo que nos hace unicos.

•Zαiяα - chαи• dijo...

ah pues mira yo tengo una mancha así justo en la punta de la lengua y supuse que era un lunar =P

no se asuste, también por evitarme bochornos no he ido a que me revisen mi lengua rara y así
jajaja

saludos!

♚Ӄѧӄǿӄɛӄѧ♚ dijo...

lo de la lengua puede ser normal????

porque hace un tiempo me di cuenta que tengo unas manchitas tambien y me dio miedo =(

super hipocondriaca la niña!! casi estaba mandando hacer mi ataud =S

pero ahora se que es porque somos de buena raza 0_0

xD


saludos!!

Dacrux dijo...

coooooooooool que chingona esta, ahora me caes mucho mejor, vaya que si es unica jamas de los jamaseses habia visto nada parecido, ni viendo aunque usted no lo crea hahahahaha la neta esta bien chidota

Dacrux dijo...

luego de mi sorpresa me fui inmediatamente a buscar un por que hahahahaha ya lo encontre pero pa no arruinarte el que tu no quieras saber no digo mas hahahahaah aun asi que chida se ve :D

Mar dijo...

Jajajá, nunca había visto una lengua con manchas.

Chistoso.

CRUDO dijo...

jjaja no se porque te extraña tener la lengua negrita, si asi estas toda tu, es mas, no tienes blanquitas ni las palmas de las manos, que regularmente esa parte es mas clara.

Xb

Vie[n]na dijo...

tendre que decir que me preocupas...
son mas lunares que signos de raza pura... y al final de cuentas hay lunares que estan de preocuparse... digo, quien soy yo para darte un diagnostico? ...pero sii te recomendaria miiiinimo que algun dermatologo o dentista te diga: dont worry...
iigual y soy una paranoica de lo peor, pero no esta de mas... U_u

chOcolAte sEnXuAl dijo...

aaaaaaaaaaaaaayyyyyyyyyy ay ayyyyyyyyy ya me altere por andar enseñandoles mis manchas de la lengua o.O

vizarrito: es que me ayudo un chorro usar el flash para esa foto jajajajajaja por eso me veo blanca XP

dacrux: aaaaaaaaaahhh ya tienes que decirme por que mis manchas andaleeeeeeeee

Viena: gulp por eso no voy porque se que me pueden decir que no soy pura raza sino otra cosa :S

kakoketa y zaira: entonces deberiamos de hacer un club que se llame las chicas shaw shaw o algo asi, jajajaja

lagartito y pandora: pos con todo y cosa rara me gusta mi lenguita XD (ya que jajajaj)

Jolie dijo...

acabo de descubrir y reafirmar lo que tanto he dicho... de mi me gusta todo! .. pero odio mis pies! son demasiado pequeños


un dia me pensaba cirugiar la delantera jaja pero en una de esas me dio ataque de crisis y me dije "no, no te quites mejor gastatelas con alguien" jajajajaja


aun no hallo el modo pero si lo hallo te cuento mi chocolate


beso!

protaro dijo...

es la primer foto tuya que veo y tiene que ser de tu lengua rara jejejeje.

no pues ta chido, eso te hace especial e interesante...

esta chida tu lengua... ¿a que sabra? ;) jajajaja

saludos

Rodo dijo...

Yo tapoco había visto una lengua con manchitas y dudo mucho que sea algo nocivo para tu salud.

Podrían ser lunares pero creo que esos sólo salen en la dermis.

Lo que a mí no me gusta de mi puerco es que no se ven los músculos pachoncitos cuando llego a hacer un poco de ejercicio. Tampoco me gusta mi nariz y cómo me sale la barba, cha.

Bay choco chick

pekeña dijo...

Si son lunares salieron en un lugar poco usual, pero no fijandose ni se notan jajajaja.

buen fin de semana choco!!

casacelis dijo...

Interesante... pero eso es genètica.

En donde radicas Chocolate?

Acaso en Mexicali?

Besos.

El arte de mi querida jolli

El arte de mi querida jolli
muchias graxias por el regalito